Knockdown of Glypican-1 and 5 isoforms causes proteinuria and glomerular injury in zebrafish (Danio rerio)

Components of the glycocalyx are being intensively studied for their involvement in a vast array of glomerular diseases. Among the most abundant proteoglycans in the glomerular cell glycocalyx are the heparan sulfate proteoglycans Glypican-1 and 5, expressed predominantly in glomerular endothelial and epithelial cells, respectively. We used a previously characterized zebrafish model to define the role of all different in zebrafish existing isoforms of Glypican-1 (a and b) and 5 (a,b and c) in vascular and renal pathology and tested the hypothesis that Glypican expression is important for the integrity of the glomerular barrier. Glypican morpholino knockdown in l-fabp:DBP-eGFP fish showed edematous phenotypes and a significant reduction of eye fluorescence for Glypican-1a, 5a und 5c, but not for Glypican1b and 5b isoforms. This indicates a significant loss of plasma proteins following knockdown of Glypican-1a, 5a and 5c in contrast to a conserved filtration barrier following knockdown of Glypican-1b and 5b isoforms. Knockdown of all different examined Glypican isoforms did not interfere with early nephron development as shown in the WT1b fish strain. Using electron microscopy, we could demonstrate that Glypican-1a knockdown leads to a predominantly endothelial cell injury with preservation of podocyte foot processes, while knockdown of Glypicans5a and 5c shows focal podocyte effacement with conserved endothelial structures. Ultrastructural analysis of glomeruli following knockdown of Glypicans-1b and 5b reveals normal glomerular structure. In this brief study we demonstrate in an in-vivo model that the Glypican proteoglycan family is critical in vascular and glomerular integrity. Our observations suggest a role for Glypican1a in endothelial cell and Glypican-5a and 5b in podocyte cell injury leading to subsequent loss of glomerular filtration barrier function and proteinuria. Correspondence to: Dr. med. K. Stahl,Nephrology Division, Department of Internal medicine, Hannover Medical School, Carl Neuberg Strasse 130625 Hannover, Germany, Tel: (0049) 5115326319; Fax: (0049) 511552366, E-mail: [email protected] Received: January 04, 2017; Accepted: January 17, 2017; Published: January 19, 2017 Abbreviations: hpf: hours post fertilization Introduction Quantitative changes in heparan sulfate proteoglycans have been associated with a wide range of inflammatory and proteinuric nephropathies, including diabetic nephropathy, minimal change disease, membranous nephropathy, systemic lupus associated nephropathy and various rodent models of nephrotic syndrome [1,2]. Of the diverse Glypican proteoglycan family Glypicans-1, 3, 4 and 5 are found in the human kidney. [3-5]. Recently, Okamoto et. al. identified through a genome wide association study and replication analysis a certain variant of Glypican-5 as a new susceptibility gene for acquired nephrotic syndrome [6]. Glypican-1 is one of the most important cell surface associated glomerular heparan sulfate proteoglycans and is expressed in both glomerular epithelial as well as glomerular endothelial cells 1. However, not much is known until now about a possible association of Glypican-1 with kidney disease. While in humans only six different Gypican proteins exist [7], in zebrafish ten different Glypican proteins have been isolated [8]. In contrast to humans, in zebrafish two different isoforms of Glypican-1, named Glypican-1a and 1b, and three different isoforms of Glypican 5, named Glypican-5a, 5b and 5c, have been identified 8. In this present study we examined the role of the Glypican-1 (a and b) and Glypican-5 (a,b and c) genes in glomerular and vascular physiology employing a zebrafish model. We present evidence for an important role of this protein in the development of proteinuria as well as vascular permeability and describe for the first time a model of glomerular pathology of Glypican-1 and Glypican-5 in an in-vivo setting. Materials and methods All methods applied in this study have been extensively described by our laboratory previously 9, and will therefore be described in a short fashion. Zebrafish stocks and embryos Zebrafish, Wildtype AB and the Transgenic zebrafish lines Tg(lfabp:DBP-eGFP) 10, Tg(flk:mcherry/l-fabp:DBP-eGFP) and Wt1bGFP 11, were grown and mated at 28.5°C. Embryos were kept and handled in standard E3 solution buffered with 2 mM HEPES as previously described previous 12,13. All zebrafish studies were conducted in accordance with the National Institutes of Health Guide Stahl K (2017) Knockdown of Glypican-1 and 5 isoforms causes proteinuria and glomerular injury in zebrafish (Danio rerio) Nephrol Renal Dis, 2017 doi: 10.15761/NRD.1000117 Volume 2(1): 2-5 for the Care and Use of Laboratory Animals and were approved by the Institutional Animal Care and Use Committee (IACUC) under approval #14-06. Zebrafish morpholino injection As decribed before by our group, Glypican-1a and 1b, Glypican 5a, 5b and 5c as well as control morpholinos were injected into one to four-cell stage fertilized embryos at a concentration of 100μM. Morpholino sequences were ordered from GeneTools (Philomath, OR) as follows: control sequence 5’ CCTCTTACCTCAGTTACAATTTATA-3’, Glypican-1a sequence 5’ AAAAAGAGCTGTTGACTCACTGTCA-3’, Glypican-1b sequence 5’ CAGCAGGACCGATTCACCTACCGGA-3’, Glypican-5a sequence 5’ TAACCACACACTCATCCTCTCACCT-3’, Glypican-5b sequence 5’ AATGTTTTTGGACCTACCTGGTTGA-3’ and Glypican-5c sequence 5’ACATGACGGCATTTCAGTGGAGAAA -3’. The Glypican1a/1b/5a/5b morpholino constructs act as a splice donor, initiating wrong pre-mRNA splicing in the region between exon2-intron2/ exon1-intron1/exon1-intron1/exon7-intron7, respectively. The Glypican-5c morpholino construct works as a translation blocker by binding close to the translational start site of the′complementary mRNA in the 5 -untranslated region. Fluorescence proteinuria measurements –fabp eye assay 72 hours post fertilization (hpf) dechorionated Tg(l fabp:DBPeGFP) embryos were anesthetized with a 1:20 to 1:100 dilution of 4 mg/ml Tricaine, placed in 200 μl E3 in single wells of 96 well plates and allowed to recover. Sequential images of live fish were then generated 96 and 120hpf using the Axiovert 200 microscope connected to an AxioCam charge-coupled device camera, and images were taken using the Axio Vision release 4.5 SP1 software package. The maximum fluorescence intensities of grayscale images of the pupil of the fish were measured using NIH’s ImageJ application and reported in relative units of brightness as previously described by our group. Assay for glomerular fusion – WT1b fish Normal development and the fusion of the zebrafish pronephros was documented in the WT1b:eGFP fish line 72hpf for all Glypican isoforms at a morpholino concentration of 100 μM. Histology and transmission electron microscopy (TEM) Morphant larval zebrafish were sampled at 120 hpf and fixed, washed and embedded with epon according to manufacturer’s protocol (Hard Plus Resin 812, Electronmicroscopy Sciences, Hatfield, PA). Ultrathin sections of 70-90 nm were imaged using a JEOL-1230 or a Morgagni (FEI, Eindhoven) transmission electron microscope, operated at 80 kV.